[Header],,,,,,,, IEMFileVersion,4,,,,,,, Investigator_Name,Name,,,,,,, Experiment_Name,PG_Seq,,,,,,, Date,2019_00_00,,,,,,, Workflow,Resequencing,,,,,,, Application,Resequencing,,,,,,, Assay,TruSeq_LT,,,,,,, Description,,,,,,,, Chemistry,Default,,,,,,, ,,,,,,,, [Reads],,,,,,,, 76,,,,,,,, ,,,,,,,, [Settings],,,,,,,, FlagPCRDuplicates,1,,,,,,, ReverseComplement,0,,,,,,, VariantFilterQualityCutoff,30,,,,,,, outputgenomevcf,FALSE,,,,,,, RunBwaAln,0,,,,,,, Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,,,,,,, AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,,,,,,, ,,,,,,,, [Data],,,,,,,, Sample_ID,Sample_Name,Sample_Plate,Sample_Well,I7_Index_ID,index,GenomeFolder,Sample_Project,Description Sample_1,Sample_1,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_2,Sample_2,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_3,Sample_3,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_4,Sample_4,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_5,Sample_5,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_6,Sample_6,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_7,Sample_7,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_8,Sample_8,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_9,Sample_9,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_10,Sample_10,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_11,Sample_11,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_12,Sample_12,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_13,Sample_13,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_14,Sample_14,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_15,Sample_15,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_16,Sample_16,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_17,Sample_17,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_18,Sample_18,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_19,Sample_19,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_20,Sample_20,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_21,Sample_21,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_22,Sample_22,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_23,Sample_23,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_24,Sample_24,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_25,Sample_25,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_26,Sample_26,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_27,Sample_27,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_28,Sample_28,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_29,Sample_29,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_30,Sample_30,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_31,Sample_31,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_32,Sample_32,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_33,Sample_33,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_34,Sample_34,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_35,Sample_35,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_36,Sample_36,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_37,Sample_37,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_38,Sample_38,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_39,Sample_39,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_40,Sample_40,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_41,Sample_41,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_42,Sample_42,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_43,Sample_43,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_44,Sample_44,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_45,Sample_45,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_46,Sample_46,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_47,Sample_47,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,, Sample_48,Sample_48,,,,,Homo_sapiens\UCSC\hg19\Sequence\WholeGenomeFasta,,