BARCODE SERIES: MULTIPLEXING WITH INDEXES OF VARYING LENGTHS

Multiplexing Libraries Containing Indexes of Different Lengths

Sample multiplexing, also known as multiplex sequencing, allows libraries to be pooled and sequenced simultaneously during a single run on Illumina® instruments. When you are working with libraries obtained with different library preparation kits, or different vendors, it is not uncommon that libraries will have indexes of different lengths, raising the question of whether is possible to mix them or not.

Pooling libraries with different index lengths in the same NGS run is possible, as long as each sample has a unique index. If, for example, you are trying to combine a library with 8 nt and another one with 12 nt index, the first 8 nt have to be unique amongst each of them.

To ensure compatibility of the libraries, you will have to modify the index sequences listed in the sample sheet. Following the previous example, if you are pooling libraries with indexes 12 nt and 8 nt, you should set the index length of the run to 12 nt, and “add” 4 bases to the end of each 8 nt index, so the final length of the indexes of all samples is 12.

Multiplexing Indexes

The Illumina® sequencers accept a single index read length on each run. As we have set the index read to have a length of 12, in the short libraries the read will pass the index region and will sequence 4 bases of the adapter.

Depending on the difference between the short and the long library, the number of bases to be added to the short libraries will be different. So, let’s say we want to combine in the same pool NEXTFLEX-HT™ Barcodes (12 nt) with our NEXTFLEX® DNA Barcodes (6 nt).

NEXTFLEX-HT™ Barcodes (P7 sequence)

GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG

NEXTFLEX® DNA Barcodes (P7 sequence)

GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXATCTCGTATGCCGTCTTCTGCTTG

In this case you will have add in the sample sheet 6 nt to the NEXTFLEX® DNA Barcodes, to have at the end a length of 6+6 = 12

NEXTFLEX® DNA Barcodes Index Modified Index for Sample Sheet
Barcode Adapter 1 CGATGT CGATGTATCTCG
Barcode Adapter 2 TGACCA TGACCAATCTCG
Barcode Adapter 3 ACAGTG ACAGTGATCTCG
Barcode Adapter 4 GCCAAT GCCAATATCTCG
Barcode Adapter 5 CAGATC CAGATCATCTCG
Barcode Adapter 6 CTTGTA CTTGTAATCTCG

Since the added bases are the same in all the short libraries, we recommend > 50% of the pool consists of libraries with longest index.  This will ensure there is sufficient base diversity in the last four bases of the index read. If this rule is not followed, the run won’t fail, but the quality of the last bases will drop.

See our complete line of sequence validated NEXTFLEX® NGS barcodes for multiplexing. We have barcodes to meet your needs.

Read our Next Tech Tip on NGS Multiplexing: Low Level Multiplexing

Recent Posts

Archives

Categories

Recent Tweets

For research use only. Not for use in diagnostic procedures.